COMP3506/7505 Algorithms and Data Structures Semester 2, 2023
Hello, dear friend, you can consult us at any time if you have any questions, add WeChat: daixieit
Assignment One – 15%
Algorithms and Data Structures – COMP3506/7505 – Semester 2, 2023
Due: 3pm on Friday September 1st (week 6)
Summary
The main objective of this assignment is to get your hands dirty with some simple data structures and algorithms to solve basic computational problems. These data structures will also come in handy for your second assignment, so you should take your time to think about your implementations and try to make them as efficient as possible.
1 Getting Started
Before we get into the nitty gritty, we will discuss the skeleton codebase that will form the basis of your implementations, and provide some rules that must be followed when implementing your solutions.
1.1 Codebase
The codebase contains a number of data structures stubs that you should implement, as well as some scripts that allow your code to be tested. Figure 1 shows a snapshot of the project directory tree with the different files categorized.
structures
![]()
m_extensible_list.py
![]()
m_single_linked_list.py
![]()
m_stack.py
data
large.refgrid
medium.refgrid
small.refgrid
tiny.refgrid
execute_refgrid.py
test_structures.py
Figure 1 The directory tree organized by data structures (inside the structures directory), test data (inside the data directory), and the two executable programs (in the root directory).
1.2 Implementation Rules
The following list outlines some important information regarding the skeleton code, and your implementation. If you have any doubts, please ask on Ed discussion.
B The code is written in Python and, in particular, should be executed with Python 3 or higher. The EAIT student server, moss, has Python 3.6.8 installed by default. We recommend using moss for the development and testing of your assignment, but you can use your own system if you wish.
B You are not allowed to use built-in methods or data structures – this is an algorithms and data structures course, after all. If you want to use a dict (aka {}), you will need to imple- ment that yourself. Lists can be used as “dumb arrays” by manually allocating space like
2 COMP3506/7505 – Semester 2, 2023
myArray = [None] * 10 but you may not use built-ins like append, clear, count, copy, extend, index, insert, pop, remove, reverse, sort, min, max, and so on. List slicing is also prohibited, as are functions like sorted, len, reversed, zip. Be sensible – if you need the functionality provided by these methods, you may implement them yourself. Similarly, don’t use any other collections or structures such as set or tuple (for example; mytup = ("abc", 123)).
B You are not allowed to use libraries such as numpy, pandas, scipy, collections, and so on.
B Exceptions: The only additional libraries you can use are random and math. You are allowed to use range and enumerate to handle looping.
2 Task 1: Data Structures (7 marks for 3506, 9 marks for 7505)
We’ll start off by implementing some fundamental (but very important) data structures. As you will see, both linked lists (Task 1.1) and extensible lists (Task 1.2) can be used as the basis of a variety of other structures including stacks (Task 1.3).
Task 1.1: Fix the Singly Linked List (1 mark)
Your first task is to examine the m_single_linked_list.py file to see how a canonical linked list can be implemented. There are two classes inside this file: the SingleNode is the structure that holds both the satellite data object, as well as a pointer (aka reference) to the location of the next node; the SingleLinkedList is the structure that keeps track of the head of the list, the size of the list (the number of nodes in the chain), and also the implementation of various functionality.
You should read each method and the constructors to understand the code, and find the two bugs in the implementation. You should fix those bugs once you find them, but do not edit anything else. There is a sample test suite that you can run via python3 test_structures.py --linked-list.1 You are free to modify this test method as much as you want — this is a good way to locate and fix the bugs! Note that the autograder will also give you some basic test results, so you can check your solution there (by submitting your work) as well.
Task 1.2: Implement an Extensible List (2 marks)
Unlike the linked lists discussed above, which can store nodes at any abitrary location in memory, we often prefer to have data items stored contiguously (consecutively in memory), allowing us to access an element x at some index i in constant time. One such way to achieve this is through the use of an extensible list (aka a dynamic array).
The file m_extensible_list.py contains a skeleton object for you to implement. You should store your data in self._data, and you can add any other member variables to your ExtensibleList object. Each function that needs to be supported is provided as a stub. Your implementations should be efficient and correct. You will need to implement your own tests and run them using python3 test_structures.py --ex-list. (See Ed posts #34 and #128 for more useful discussion on this class.)
Task 1.3: Implement a Stack or two... (4 marks)
Recall that a stack provides last-in-first-out (LIFO)2 ordering of the data, with constant-time access to the most recently pushed element.
Our last objective in this part is to implement two different stacks (see m_stack.py).
The first is called an EStack and will inherit our ExtensibleList as the underlying data storage mechanism. The second is called an LStack and will inherit the SingleLinkedList as the storage mechanism.
Since we have two stack versions, you will need to decide which methods to override (if any) from the base classes, and implement the push(x), pop(), peek(), and empty() functionality in the stack classes themselves. You must override any functions from the base classes that should not be called by your stack (we wouldn’t want to call find_and_remove(x) on a stack, for example) to avoid any accidents. (See ed discussion #99 for more information).
Implement test cases and run them using python3 test_structures.py --ex-stack and python3 test_structures.py --linked-stack.
Task 1.4: Benchmark Stacks (2 marks for COMP7505)
æ Optional and Unmarked for COMP3506
Our final objective in this part is to benchmark your stacks. In particular, you should look at the benchmark_stacks() function inside test_structures.py to see how a basic microbenchmark can be implemented. In this case, we simply generate a fixed number of random integers, push them all onto the stack, and pop them all out again, measuring the time taken. The benchmark can be executed via python3 test_structures.py --bench-stacks 1000 where 1000 represents the number of random integers to generate in the benchmark.
Consider the expected rate of growth of runtime when increasing n – the expected complexity of both push(x) and pop() – what do you expect to see happen as you increase n in the benchmark?
Submission
You should run the benchmark with 10 different values of n (your choice, but try to use values that provide timings greater than 0.1 seconds at a minimum) and record the output in a file called stackbench.txt. You should use the specified format as we will be using scripts to extract the information (space or tab delimiting is OK). Please see Figure for more details.
If you are a COMP3506 student and you wish to submit your benchmark, please use the filename stackbench-3506.txt.
1 [n val] [EStack time] [LStack time] 1 1000 3.5 4.7
2 [n val] [EStack time] [LStack time] 2 10000 10.1 11.6
3 [n val] [EStack time] [LStack time] 3 100000 22.8 31.3
4 [n val] [EStack time] [LStack time] 4 1000000 32.2 40.6
5 [n val] [EStack time] [LStack time] 5 10000000 50.7 101.5
...
Figure 2 The format of the stackbench.txt file (left) and an example output (right). Note: The
values are examples only, and only the first 5 of 10 lines are displayed.
3 Task 2: Problem Solving with Data Structures (8 marks)
You are a bioinformatician working at Frankenstein LabsTM , a world leader in futuristic genome editing technology that has promising applications for anti-ageing, cloning, and superhuman intelligence. As a bioinformatician, you often work with DNA data. DNA data is represented as a string S of length |S| over an alphabet Σ = {a, c, g, t}. Each character represents a different base (a is adenine , c is cytosine , g is guanine, and t is thymine). For example, a sequence might look like S = gaatacgg where |S| = 8.
One of the latest innovations from Frankenstein Labs is known as the DNA-RefGrid which, among other things, can be used to fold multiple strands of DNA together in interesting (and sometimes frightening!) ways. The DNA-RefGrid is a simple n ◊ |S| matrix containing n different strands of DNA, each of the same initial length |S|, and can be represented as a text file. The following example shows a DNA-RefGrid file containing n = 4 strings with |S| = 12:
gtacggttaacc
gctctggactct
atggtgtcctca
ctgctgccccta
Figure 3 The format of the .refgrid file type.
Getting Started
We have provided you with an executable program called execute_refgrid.py that contains a RefGrid class. You need to implement the functionality inside that class to solve the following tasks. To get you started, we provide code that can read a .refgrid file into a singly linked list (self.linkedlist) or an extensible list (self.extlist) once correctly implemented. You are free to (and should) utilize your data structures from Task 1 within the implementation of your RefGrid class where appropriate.
Task 2.1: Sequence Reversal (2 marks)
Given the RefGrid loaded into the self.linkedlist structure, your first task is to implement a method that reverses the k th sequence of the RefGrid in linear time. This functionality can be tested using the --reverse-k argument to the execute_refgrid.py program. For example, assuming the example file in Figure 3 is stored in example.refgrid, then running python3 execute_refgrid.py --refgrid my.refgrid --reverse-k 2 should output:
gtacggttaacc
gctctggactct
actcctgtggta
ctgctgccccta
Note the value of k is zero-indexed, and that you should validate the value of k and handle out-of-bounds cases elegantly (just ignore the reversal and store the file as-is). This method should be destructive (it should modify the stored data in place, not generate a new copy of the data). Hint: One of your stacks might come in handy here.
Task 2.2: Grid-Based Cutting and Splicing (3 marks)
Your next task is to implement cut-and-splice routine. The idea is as follows. Given a pattern P and a target sequence T, replace all occurrences of P with T. To simplify this task, you may assume that both P and T make use of each base just once (that is, you can not supply a pattern or target like gg or ttccc) and that both P and T are not empty.
For example, given an initial string S = gtcaggtcccaccgcc, P = ca and T = cgt, the cut-and-splice would look like:
gtcaggtcccaccgcc (before)
gtcgtggtcccgtccgcc (after)
Although we are not operating on a single string S, but rather a RefGrid with n strings, the cut-and-splice operation works the same on a per-sequence basis. Thus, you need to take care not to allow pattern matches across sequences, only within each sequence. Again, this method should be destructive and modify the stored data in place, instead of generating a new copy of the data. You should use the linked list to store/modify the original RefGrid, and use the ex- tensible list to store the length of each row; implement the stringify_spliced_linkedlist function to handle printing the spliced data. Test via: python3 execute_refgrid.py
--refgrid my.refgrid --cut-and-splice pattern:target
Task 2.3: Cloning Viability (3 marks)
The holy grail of Frankenstein Labs is their cloning technology. However, in order to determine whether a series of DNA sequences (as provided in a RefGrid) are viable for cloning, an algorithm needs to determine if there is an L-path through the sequences. An L-path is simply described as a path through the RefGrid from the top-left to the bottom-right that matches the following conditions: (1) The path consists of entirely the same base; and (2)
The path can only ever go downwards or to the right.
gtaca atgca
gggaa attgt
ccggg tcgca
ctgag ggtca
Figure 4 The sequences in the left RefGrid are viable for cloning, but those in the right are not.
You need to implement an algorithm that returns True if an L-path exists, or False otherwise. Luckily, your colleague and renowned algorithms legend Barry Malloc has been thinking about how to solve this problem and has given you his notes. Use Barry’s notes to help you implement the left and below helper functions, and to then implement his solution in Algorithm 1. Test via: python3 execute_refgrid.py --refgrid my.refgrid --check-clone To make things a little bit easier, you may assume that the input RefGrid has not been subject to any cutting and splicing (so all rows are of the same length).
Barry Malloc to the Rescue
B We will read the input data, in order, into one single extensible list (A in Algorithm 1).
B We will initialize a stack to keep track of our traversal, and a linked list to keep track of indexes we have visited.
B We need to write two helper functions that allow us to map from a given array index i to a new index j, see Figure 5:
The first will map index i to the index of the element to the right; call it right(i). It will return 0 if there is nothing to our right.
The second will map index i to the index of the element below; call it below(i). It will return 0 if there is nothing below.
B We can now solve our problem using a stack of array indexes (Algorithm 1).
Input File
gtacgtta
gcgtagtc
tgcgacaa
atccaccc
Read to ExtensibleList
0 8 16 24
![]()
gtacgttagcgtagtctgcgacaaatccaccc
n = 4, |S| = 8 -> Length = 8*4=32
Note: row k will begin at index k*|S| Row 0 starts at 0 * 8 = 0
Row 1 starts at 1 * 8 = 8
...
The right(i) function returns the indexof the
element to the right of index i if valid, 0 otherwise.
|
right(3)= 4 |
3 4 gtacgtta gcgtagtc tgcgacaa atccaccc |
|
3 4 gtacgttagcgtagtctgcgacaaatccaccc |
|
|
right(7)= 0 |
7 0 gtacgtta gcgtagtc tgcgacaa atccaccc |
|
7 gtaagttagcgtagtctgcgacaaatccaccc |
|
The below(i) function returns the indexof the element below index i if valid, 0 otherwise.
|
below(3)= 11
3 11 |
3 gtacgtta 11 gcgtagtc tgcgacaa atccaccc |
|
|
gtacgttagcgtagtctgcgacaaatccaccc |
||
|
below(26)= 0 gtacgtta gcgtagtc tgcgacaa atccaccc |
26 |
|
|
26 gtaagttagcgtagtctgcgacaaatccaccc |
||
Figure 5 Barry’s diagrams showing how to map the 2-dimensional RefGrid into a single list, and then how the helper functions work on that single list.
Algorithm 1 A stack-based algorithm to solve the cloning viability problem. Assumes you have read the input into an ExtensibleList called A that can be accessed throughout the computation.
|
1: procedure IsViable(A) |
|
|
2: |
myStack Ω ÿ Û Make an empty stack |
|
3: |
visited Ω ÿ Û Make an empty linked list to keep track of visited indexes |
|
4: |
cur Ω 0 Û Start index is the top-left |
|
5: |
end Ω A.length ≠ 1 Û End index is the bottom-right |
|
6: |
base Ω A[cur] Û This is the target base character |
|
7: |
Push(myStack , cur) |
|
8: |
Insert(visited , cur) |
|
9: |
while NotEmpty(myStack) and cur != end do |
|
10: |
cur = Pop(mystack) Û Get the next candidate cell (index) |
|
|
|
2023-08-22